91
|
Thermo Fisher
cg06712013 spats2 atggttggagtagatgagat acaccactacactccaccct seq id Cg06712013 Spats2 Atggttggagtagatgagat Acaccactacactccaccct Seq Id, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/seq+id/us11268148-317-47-85?v=Thermo+Fisher Average 91 stars, based on 1 article reviews
cg06712013 spats2 atggttggagtagatgagat acaccactacactccaccct seq id - by Bioz Stars,
2026-07
91/100 stars
|
Buy from Supplier |
86
|
GenScript corporation
seq id Seq Id, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/seq+id/us10435668-683-43-49?v=GenScript+corporation Average 86 stars, based on 1 article reviews
seq id - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
86
|
Medicago
seq id Seq Id, supplied by Medicago, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/seq+id/us12516336-417-51-131?v=Medicago Average 86 stars, based on 1 article reviews
seq id - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
91
|
Thermo Fisher
cg08913523 na ggttttgtgggttggaagttag accaccccctccttcaacta seq id Cg08913523 Na Ggttttgtgggttggaagttag Accaccccctccttcaacta Seq Id, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/seq+id/us11268148-317-35-85?v=Thermo+Fisher Average 91 stars, based on 1 article reviews
cg08913523 na ggttttgtgggttggaagttag accaccccctccttcaacta seq id - by Bioz Stars,
2026-07
91/100 stars
|
Buy from Supplier |
90
|
Carl Zeiss
gxxx-fniii9-10 (seq id no:20) Gxxx Fniii9 10 (Seq Id No:20), supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/seq+id/us08513380-739-5-17?v=Carl+Zeiss Average 90 stars, based on 1 article reviews
gxxx-fniii9-10 (seq id no:20) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Sequiserve GmbH
d-amidase sequence (seq id no:1) D Amidase Sequence (Seq Id No:1), supplied by Sequiserve GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/seq+id/us07070963-179-5-16?v=Sequiserve+GmbH Average 90 stars, based on 1 article reviews
d-amidase sequence (seq id no:1) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
TIB MOLBIOL
agcttggccggccgtytcggccggcca seq id 7 Agcttggccggccgtytcggccggcca Seq Id 7, supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/seq+id/us07074772-191-40-52?v=TIB+MOLBIOL Average 90 stars, based on 1 article reviews
agcttggccggccgtytcggccggcca seq id 7 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Commonwealth Biotechnologies Inc
humgrp5e p5 (seq id no:1300) assay development Humgrp5e P5 (Seq Id No:1300) Assay Development, supplied by Commonwealth Biotechnologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/seq+id/us07667001-2225-0-19?v=Commonwealth+Biotechnologies+Inc Average 90 stars, based on 1 article reviews
humgrp5e p5 (seq id no:1300) assay development - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Bachem
qhnpr (seq id no: 2) peptide Qhnpr (Seq Id No: 2) Peptide, supplied by Bachem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/seq+id/us07625713-185-1-15?v=Bachem Average 90 stars, based on 1 article reviews
qhnpr (seq id no: 2) peptide - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Ella Biotech GmbH
forward primer 5′-gctgtgtgactcctgcaa-3′ (seq id no: 27) Forward Primer 5′ Gctgtgtgactcctgcaa 3′ (Seq Id No: 27), supplied by Ella Biotech GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/seq+id/us09790507-20-34-41?v=Ella+Biotech+GmbH Average 90 stars, based on 1 article reviews
forward primer 5′-gctgtgtgactcctgcaa-3′ (seq id no: 27) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Microsynth ag
5′ phosphorylated linker seq id: 10 5′ Phosphorylated Linker Seq Id: 10, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/seq+id/us10538795-358-5-8?v=Microsynth+ag Average 90 stars, based on 1 article reviews
5′ phosphorylated linker seq id: 10 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
sequence (seq id no. 101) Sequence (Seq Id No. 101), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/seq+id/us10563208-594-19-27?v=GenScript+corporation Average 90 stars, based on 1 article reviews
sequence (seq id no. 101) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |