seq id Search Results


cg06712013 spats2 atggttggagtagatgagat acaccactacactccaccct seq id  (Thermo Fisher)
91
Thermo Fisher cg06712013 spats2 atggttggagtagatgagat acaccactacactccaccct seq id
Cg06712013 Spats2 Atggttggagtagatgagat Acaccactacactccaccct Seq Id, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cg06712013 spats2 atggttggagtagatgagat acaccactacactccaccct seq id/product/Thermo Fisher
Average 91 stars, based on 1 article reviews
cg06712013 spats2 atggttggagtagatgagat acaccactacactccaccct seq id - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier
seq id  (GenScript corporation)
86
GenScript corporation seq id
Seq Id, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/seq id/product/GenScript corporation
Average 86 stars, based on 1 article reviews
seq id - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier
cg08913523 na ggttttgtgggttggaagttag accaccccctccttcaacta seq id  (Thermo Fisher)
91
Thermo Fisher cg08913523 na ggttttgtgggttggaagttag accaccccctccttcaacta seq id
Cg08913523 Na Ggttttgtgggttggaagttag Accaccccctccttcaacta Seq Id, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cg08913523 na ggttttgtgggttggaagttag accaccccctccttcaacta seq id/product/Thermo Fisher
Average 91 stars, based on 1 article reviews
cg08913523 na ggttttgtgggttggaagttag accaccccctccttcaacta seq id - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier
cg02482497 c1orf77 tgttgtgagttttgaaggtgtt acccattctctcacctactt seq id  (Thermo Fisher)
91
Thermo Fisher cg02482497 c1orf77 tgttgtgagttttgaaggtgtt acccattctctcacctactt seq id
Cg02482497 C1orf77 Tgttgtgagttttgaaggtgtt Acccattctctcacctactt Seq Id, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cg02482497 c1orf77 tgttgtgagttttgaaggtgtt acccattctctcacctactt seq id/product/Thermo Fisher
Average 91 stars, based on 1 article reviews
cg02482497 c1orf77 tgttgtgagttttgaaggtgtt acccattctctcacctactt seq id - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier
t-select hla-a*02:01 cmv pp65 tetramernlvpmvatv-pe  (MBL Life science)
90
MBL Life science t-select hla-a*02:01 cmv pp65 tetramernlvpmvatv-pe
T Select Hla A*02:01 Cmv Pp65 Tetramernlvpmvatv Pe, supplied by MBL Life science, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t-select hla-a*02:01 cmv pp65 tetramernlvpmvatv-pe/product/MBL Life science
Average 90 stars, based on 1 article reviews
t-select hla-a*02:01 cmv pp65 tetramernlvpmvatv-pe - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
pentapeptide l-ala-c-d-glu-l-lys-d-ala-d-ala  (Bachem)
90
Bachem pentapeptide l-ala-c-d-glu-l-lys-d-ala-d-ala
Pentapeptide L Ala C D Glu L Lys D Ala D Ala, supplied by Bachem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pentapeptide l-ala-c-d-glu-l-lys-d-ala-d-ala/product/Bachem
Average 90 stars, based on 1 article reviews
pentapeptide l-ala-c-d-glu-l-lys-d-ala-d-ala - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
a peptides corresponding to the human a amino acids 25–35 and 1–42  (American Peptide Company Inc)
90
American Peptide Company Inc a peptides corresponding to the human a amino acids 25–35 and 1–42
A Peptides Corresponding To The Human A Amino Acids 25–35 And 1–42, supplied by American Peptide Company Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/a peptides corresponding to the human a amino acids 25–35 and 1–42/product/American Peptide Company Inc
Average 90 stars, based on 1 article reviews
a peptides corresponding to the human a amino acids 25–35 and 1–42 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
fitc-(pr)15  (GenicBio BioTech Co Ltd)
90
GenicBio BioTech Co Ltd fitc-(pr)15
Fitc (Pr)15, supplied by GenicBio BioTech Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fitc-(pr)15/product/GenicBio BioTech Co Ltd
Average 90 stars, based on 1 article reviews
fitc-(pr)15 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
art-2 peptide labeled with fitc  (GenScript corporation)
90
GenScript corporation art-2 peptide labeled with fitc
Human umbilical vein endothelial cells were treated <t>with</t> <t>ART-2-FITC</t> liposomes or control-FITC liposomes for 2 h at the indicated four concentrations (A & B) or for different duration of time at one concentration (0.5 μM) (C & D) and then examined by flow cytometry. For each set, the fluorescence intensity is shown as a histogram as well as a graph. FITC: Fluorescein isothiocyanate. *p < 0.01.
Art 2 Peptide Labeled With Fitc, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/art-2 peptide labeled with fitc/product/GenScript corporation
Average 90 stars, based on 1 article reviews
art-2 peptide labeled with fitc - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
multiple cloning site oligos 5′aattaccgcggggcgcgccgtttaaacgcatgccaattgggccggccg3′ (seq id no: 18)  (Oligos Etc)
90
Oligos Etc multiple cloning site oligos 5′aattaccgcggggcgcgccgtttaaacgcatgccaattgggccggccg3′ (seq id no: 18)
Human umbilical vein endothelial cells were treated <t>with</t> <t>ART-2-FITC</t> liposomes or control-FITC liposomes for 2 h at the indicated four concentrations (A & B) or for different duration of time at one concentration (0.5 μM) (C & D) and then examined by flow cytometry. For each set, the fluorescence intensity is shown as a histogram as well as a graph. FITC: Fluorescein isothiocyanate. *p < 0.01.
Multiple Cloning Site Oligos 5′Aattaccgcggggcgcgccgtttaaacgcatgccaattgggccggccg3′ (Seq Id No: 18), supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/multiple cloning site oligos 5′aattaccgcggggcgcgccgtttaaacgcatgccaattgggccggccg3′ (seq id no: 18)/product/Oligos Etc
Average 90 stars, based on 1 article reviews
multiple cloning site oligos 5′aattaccgcggggcgcgccgtttaaacgcatgccaattgggccggccg3′ (seq id no: 18) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
sequence seq id no:36  (Biotechnology Information)
90
Biotechnology Information sequence seq id no:36
Human umbilical vein endothelial cells were treated <t>with</t> <t>ART-2-FITC</t> liposomes or control-FITC liposomes for 2 h at the indicated four concentrations (A & B) or for different duration of time at one concentration (0.5 μM) (C & D) and then examined by flow cytometry. For each set, the fluorescence intensity is shown as a histogram as well as a graph. FITC: Fluorescein isothiocyanate. *p < 0.01.
Sequence Seq Id No:36, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sequence seq id no:36/product/Biotechnology Information
Average 90 stars, based on 1 article reviews
sequence seq id no:36 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
homolog (seq id no: 14)  (Gallus BioPharmaceuticals)
90
Gallus BioPharmaceuticals homolog (seq id no: 14)
Human umbilical vein endothelial cells were treated <t>with</t> <t>ART-2-FITC</t> liposomes or control-FITC liposomes for 2 h at the indicated four concentrations (A & B) or for different duration of time at one concentration (0.5 μM) (C & D) and then examined by flow cytometry. For each set, the fluorescence intensity is shown as a histogram as well as a graph. FITC: Fluorescein isothiocyanate. *p < 0.01.
Homolog (Seq Id No: 14), supplied by Gallus BioPharmaceuticals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/homolog (seq id no: 14)/product/Gallus BioPharmaceuticals
Average 90 stars, based on 1 article reviews
homolog (seq id no: 14) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


Human umbilical vein endothelial cells were treated with ART-2-FITC liposomes or control-FITC liposomes for 2 h at the indicated four concentrations (A & B) or for different duration of time at one concentration (0.5 μM) (C & D) and then examined by flow cytometry. For each set, the fluorescence intensity is shown as a histogram as well as a graph. FITC: Fluorescein isothiocyanate. *p < 0.01.

Journal: Nanomedicine

Article Title: Peptide-targeted liposomal delivery of dexamethasone for arthritis therapy

doi: 10.2217/nnm-2018-0501

Figure Lengend Snippet: Human umbilical vein endothelial cells were treated with ART-2-FITC liposomes or control-FITC liposomes for 2 h at the indicated four concentrations (A & B) or for different duration of time at one concentration (0.5 μM) (C & D) and then examined by flow cytometry. For each set, the fluorescence intensity is shown as a histogram as well as a graph. FITC: Fluorescein isothiocyanate. *p < 0.01.

Article Snippet: ART-2 peptide (CKPFDRALC; Supplementary Figure 1 ) labeled with FITC or Cy7, and ART-2-lipopeptide (CKPFDRALC-NH-C 18 H 37 ) ( A) were synthesized by GenScript/Lifetein (NJ, USA).

Techniques: Liposomes, Control, Concentration Assay, Flow Cytometry, Fluorescence